CD34+ Cell Isolation and Bisulfite Pyrosequencing

Primary samples were incubated for 15 min in phosphate-buffered saline (PBS) with 2% fetal calf serum and CD34 antibody (BD Biosciences, UK). After washing in PBS (+2% fetal calf serum) and DAPI, samples were filtered through a cell strainer and transferred to FACs tubes. Then, samples were sorted using BD FACS Aria II cell sorter (BD Biosciences, UK) into CD34⁺ and CD34⁻ cells. Bisulfite pyrosequencing was done as described (20 (link)) using the following primer sequences: forward, GGTTTTATTTAGGGTAGAGTAGATT; reverse (BIOTINYLATED), CCCCCTTCTTTCTATACCCAATACCATATC; sequencing primer, ACCAACTTACCCCAA.