Base Editor-Mediated PRPF6 Modification

We removed cas9/GFP from PX461 (Addgene #48140) (Ran et al., 2013 (link)) and replaced with GFP/Zeocin from pTRACER-EF/V5-His A (Life Technologies). GFP/Zeocin expression was controlled by the CMV promoter on PX461.s gRNA GGCGCGGGAAGCCTATAACC (PAM AGG) to target PRPF6 c.2185C > T p.Arg729Trp was cloned into the BbsI sites, for expression from the U6 promoter. This was co-transfected with pCMV-BE3 (Addgene #73021) (Komor et al., 2016 (link)) which contains the BE3 gene (Base Editor; cytidine deaminase) under the control of a CMV promoter, into HEK293 cells using PEI. Cells were selected with zeocin.

Free full text: Click here

Nazlamova L., Villa Vasquez S.S., Lord J., Karthik V., Cheung M.K., Lakowski J, & Wheway G. (2022). Microtubule modification defects underlie cilium degeneration in cell models of retinitis pigmentosa associated with pre-mRNA splicing factor mutations. Frontiers in Genetics, 13, 1009430.

Publication 2022

pCMV-BE3

Cells Cytidine deaminase Gene Hek293 cells Zeocin

Corresponding Organization : University of Southampton

Other organizations : University of the West of England

Top 5 similar protocols

Variable analysis

independent variables

Removal of cas9/GFP from PX461 plasmid and replacement with GFP/Zeocin from pTRACER-EF/V5-His A plasmid
Addition of gRNA GGCGCGGGAAGCCTATAACC (PAM AGG) to target PRPF6 c.2185C > T p.Arg729Trp, expressed from the U6 promoter
Co-transfection of the modified PX461 plasmid with pCMV-BE3 plasmid containing the BE3 gene (Base Editor; cytidine deaminase) under the control of a CMV promoter

dependent variables

GFP/Zeocin expression controlled by the CMV promoter on the modified PX461 plasmid
Editing of the PRPF6 c.2185C > T p.Arg729Trp target site

control variables

HEK293 cells used as the cell line for the experiment

controls

Positive control: Not specified
Negative control: Not specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!