RPE1-hTERT cells (American tissue collection) and SV40 transformed fibroblasts, including WABS [28 (link)], RBS [36 (link)] and LN9SV control [71 (link)], were cultured in Dulbecco’s Modified Eagles Medium (DMEM, Gibco), supplemented with 10% FCS, 1 mM sodium pyruvate and antibiotics.
CRISPR-Cas9 was used to construct DDX11 and ESCO2 knockouts in RPE1 cells. The generation of RPE1-hTERT_TetOn-Cas9_TP53KO cells is also described in a currently submitted manuscript [68 ]. Briefly, Cas9 cDNA was cloned into the pLVX-Tre3G plasmid (Clontech) and lentiviral Tre3G-Cas9 and Tet3G particles were produced in HEK293T cells using the Lenti-X HT packaging system (Clontech). Transduced cells were selected with 10 μg/mL puromycin and 400 μg/mL G418. Cells were treated with 100 ng/mL doxycycline (Sigma-Aldrich) to induce Cas9 expression and transfected with 10 nM synthetic crRNA and tracrRNA (Dharmacon or IDT) using RNAiMAX (Invitrogen). The following crRNA sequences were used: TP53 (CCATTGTTCAATATCGTCCG ), DDX11-specific (GGCTGGTCTCCCTTGGCTCC ), ESCO2 (TAAGTGGTACCTCAATCCAC ). Single clones were assessed by Sanger sequencing using the following primers: TP53-Fw (GAGACCTGTGGGAAGCGAAA , TP53-Rv GCTGCCCTGGTAGGTTTTCT ), DDX11-Fw (AACAACCCACCCTCCCCAAG ), DDX11-Rv (TGCCTCACTCTCTCCAGACC ), ESCO2-Fw (ATCAAAAAGGTAGAAGATGTCCAAGAAC ), ESCO2-Rv (GCCTGTTTGATGGGTTCTGC ).
CRISPR-Cas9 was used to construct DDX11 and ESCO2 knockouts in RPE1 cells. The generation of RPE1-hTERT_TetOn-Cas9_TP53KO cells is also described in a currently submitted manuscript [68 ]. Briefly, Cas9 cDNA was cloned into the pLVX-Tre3G plasmid (Clontech) and lentiviral Tre3G-Cas9 and Tet3G particles were produced in HEK293T cells using the Lenti-X HT packaging system (Clontech). Transduced cells were selected with 10 μg/mL puromycin and 400 μg/mL G418. Cells were treated with 100 ng/mL doxycycline (Sigma-Aldrich) to induce Cas9 expression and transfected with 10 nM synthetic crRNA and tracrRNA (Dharmacon or IDT) using RNAiMAX (Invitrogen). The following crRNA sequences were used: TP53 (
Free full text: Click here
