Using homology-based search tools, we identified LOX homologues in the Botryllus Transciptome database from Rodriguez et al. (2014) (link). The contig named CAP3_round1_contig_2680 shared 43% identity to mammalian LOX1 proteins, with an E-value < 1e-39; this sequence has been deposited in the National Center for Biotechnology Information (accession number BankIt1994445 BSeq#1 KY653960). Whole-mount in situ hybridization was performed with digoxigenin-labeled probes as described by Langenbacher et al. (2015) (link). A specific antisense probe for LOX1 was synthesized from PCR products using a LOX1 clone coding for a 368–base pair–specific region of the gene (primer pairs 5′-3′-: forward, GGCGTGTGGAAGTAAAGCAC; reverse, GTGAACCTGGAAACATCGCTT). We used TSA-plus detection (NEL753001KT; PerkinElmer, Waltham, MA) with a fluorescein substrate. Representative images from eight independent experiments consisting of three individual colonies per experiment are shown. Negative controls were conducted using a sense probe from the same sequence and are shown in Supplemental Figure S1.