Quantitative PCR Analysis of Kidney Inflammation

RNA was extracted from frozen kidney tissue by trizol and chloroform separation with genomic DNA removal by DNA-free DNA removal kit (Thermo Fisher). cDNA was generated by FireScript RT kit (Solis Biodyne) as per manufacturer’s instructions. RT-PCR was performed with validated primers for Gapdh (housekeeping control) (24 (link)), Il1b (25 (link)), Tnfa (Fwd 5’ CCCTCACACTCAGATCATCTTCT 3’, Rev 5’ GCTACGACGTGGGCTACAG 3’), Ccl2 (26 (link)), Cxcl1 (27 (link)) and PowerUp SYBR Green Master Mix (Applied Biosystems) for 40 cycles under single-plex conditions (QuantStudio 6, Life Technologies). cDNA-specific amplification was ensured by inclusion of reverse transcriptase-negative and template-negative controls. Samples were run in triplicate and cycle threshold values were determined by automatic threshold analysis (QuantStudio Software), with the 2^-ΔΔCt method used to calculated relative gene expression from the average threshold of each sample, relative to the average of the C57BL/6 group.

Free full text: Click here

Gottschalk T.A., Hall P., Tsantikos E., L’Estrange-Stranieri E., Hickey M.J, & Hibbs M.L. (2022). Loss of CD11b Accelerates Lupus Nephritis in Lyn-Deficient Mice Without Disrupting Glomerular Leukocyte Trafficking. Frontiers in Immunology, 13, 875359.

Publication 2022

DNA-free DNA removal kit FireScript RT kit PowerUp SYBR Green Master Mix QuantStudio 6

Ccl2 Cdna Chloroform Cxcl1 Frozen Gapdh Gene expression Genomic Il1b Kidney Primers Reverse transcriptase Rt pcr Sybr green Tissue Tnfa Trizol

Corresponding Organization : Monash University

Other organizations : Monash Medical Centre

Top 5 similar protocols

Variable analysis

independent variables

Extraction method (Trizol and chloroform separation)
CDNA generation method (FireScript RT kit)
RT-PCR primers for target genes (Gapdh, Il1b, Tnfa, Ccl2, Cxcl1)

dependent variables

Relative gene expression of Gapdh, Il1b, Tnfa, Ccl2, Cxcl1

control variables

Frozen kidney tissue
Genomic DNA removal by DNA-free DNA removal kit
Single-plex RT-PCR conditions (QuantStudio 6)
Triplicate samples
C57BL/6 group as reference for relative gene expression

controls

Reverse transcriptase-negative controls
Template-negative controls

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!