The unigenes annotated as Avian Beta Defensin 2 (CL60147Contig), Avian Beta Defensin 13 (CL64604Contig1) and Cathelicidin 2 (CL31589Contig1) were selected for expression analysis. The expression profiles of the selected genes in 14 tissues of 3 crows were analyzed by real-time PCR using Roche -Light Cycler® 480 System. About 1 µg of total RNA extracted from each tissue was reverse transcribed using Superscript™ III First-Strand System for RT-PCR (Invitrogen). Real-time PCR was performed in 10 µl reaction containing cDNA sample, SYBR green mix, gene-specific primers (Table 4), and double-distilled water. The expression level of the three genes were measured by the 2(−ΔΔCt) method using β-actin as internal reference gene and oesophagus as calibrator tissue56 (link),120 (link)–122 (link).
Primer sequences for real time PCR.
Gene name
Forward primer
Reverse primer
Avian beta-defensin 2 (AvBD-2)
ACAGCCATGAAGATCCTTTACC
GGCAAAGACAAACCTGGAGA
Avian beta-defensin 13 (AvBD-13)
CAGCAGTGCAGAAGCAACC
ATTGCTGCAGCTCCCTTC
Cathelicidin 2 (CATH-2)
CCGTGGATTCCTACAACCAG
TCCATCATGCTGAAGTTGAGTC
β- actin
CCCCACCTGAGCGTAAATACT
CCTGCTTGCTGATCCACAT
The statistical analysis of the data was carried out using multiple t-test analysis and one-way ANOVA. Data were repeated in triplicate and plotted with GraphPad Prism 10. Differences were defined as significant if P < 0.05.
Kannoth S., Ali N., Prasanth G.K., Arvind K., Mohany M., Hembrom P.S., Sadanandan S., Vasu D.A, & Grace T. (2023). Transcriptome analysis of Corvus splendens reveals a repertoire of antimicrobial peptides. Scientific Reports, 13, 18728.
Expression levels of Avian Beta Defensin 2 (CL60147Contig), Avian Beta Defensin 13 (CL64604Contig1), and Cathelicidin 2 (CL31589Contig1) genes
control variables
β-actin as internal reference gene
Oesophagus as calibrator tissue
controls
Positive control: Not explicitly mentioned.
Negative control: Not explicitly mentioned.
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required