HSC70 Overexpression and Knockdown in Cell Lines
Corresponding Organization : University of Lausanne
Other organizations : University Hospital of Bern, Johannes Kepler University of Linz
Variable analysis
- Transient transfection of HEK 293 T cells with plasmid pLX307 encoding for HSC70 (HSPA8) using the calcium phosphate method
- Lentiviral vectors expressing shRNAs targeting HSC70 (shHSC70_1, shHSC70_2, shHSC70_3)
- Lentiviral vectors expressing shRNAs targeting LAMP2A (shRNA: CTGCAACCTGATTGATTA, shRNA: GGCAGGAGTACTTATTCTAGT)
- Knockdown efficiency of HSC70 and LAMP2A assessed by western blot analysis
- Puromycin selection of transduced NB4 and SKBR3 cell populations
- Positive control: Not explicitly mentioned
- Negative control: Not explicitly mentioned
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!