FOXO3 ChIP-qPCR at DEPP Promoter

ChIP was performed using the Millipore Magna ChIP Kit (Millipore, Darmstadt, Germany) as described previously [38 (link)]. Protein-G-magnetic-beads (20 μl) were coupled to 2.5 μl of FOXO3 antibody (Santa Cruz Biotechnology, Dallas, USA) and incubated with nuclear lysates of shredded DNA from 2 × 10⁷ SH-EP/FOXO3 cells treated with 100 nM 4OHT alone or in combination with CBX for three hours. After precipitation, protein was digested by proteinase-K. Quantitative real-time RT-PCR analyses were performed to measure binding of FOXO3 to the DEPP-promoter (DEPP-forward: CTGCTCCTAGGAGAGACACACCCTG, DEPP-reverse: CTGCTACGTTTGCTGTGCTTAGTGC).