The reporter construct contained six copies of a sequence containing duplicate cis elements bound by type-B ARRs binding site in its wild-type (TCS) (AAAATCTACAAAATCTTTTTGGATTTTGTGGATTTTCTAGC) and mutant forms (TCSm) (AAAATGTACAAAATGTTTTTGCATTTTGTGCATTTTCTAGC) as reported (Müller and Sheen, 2008), upstream of the minimal 35S promoter and the Ω translational enhancer in the pGreenII 0800-LUC vector [83 (link)]. DNA fragments containing the cis elements were amplified from the corresponding constructs in pUC18 [61 (link)] using the primers indicated in S5 Table. The effector constructs were prepared in pEarleyGate-201 and pEarleyGate-101 (ARR1), pEarleyGate-203 (M5GAI) and pEarleyGate-104 (GAI and RGA).
Transient expression in leaves of N. benthamiana was achieved by infiltrating mixtures of Agrobacterium cultures. The reporter:effector ratio was 1:4 for ARR1, while was 1:4 for GAI and M5GAI. Firefly and the control Renilla LUC activities were assayed from leaf extracts with the Dual-Glo Luciferase Assay System (Promega) and quantified with a GloMax 96 Microplate Luminometer (Promega). Control Western blots were performed with proteins extracted from the same experiment, and the ARR1, GAI, M5GAI, and RGA fusions were detected with anti-HA (3F10; Roche), anti-GFP (ab290; Abcam), anti-GAI [3 (link)] and anti-c-myc (9E10; Roche) antibodies.
Free full text: Click here