CRISPR-Cas9 Mutagenesis of appa Gene in Zebrafish

The appa gene was targeted by CRISPR/Cas9 mutagenesis. CHOPCHOP (http://chopchop.cbu.uib.no) was used to identify an sgRNA to exon 18 of appa (ENSDARG00000104279).³⁴ (link) Cas9 mRNA was made from pT3TS-nCas9n (Addgene, plasmid 46757)⁷⁷ (link) using mMESSAGE mMACHINE transcription kit (Thermofisher Scientific). Constant oligomer (5′AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCT AGCTCTAAAAC-3′) and the appa gene-specific oligomer targeting the conserved 25-42 amino acid region of Aβ in appa (target sequence: 5′-GAGGACGTGAGCTCCAATAA- 3′) were annealed on a PCR machine (using the program 95°C, 5 min; 95°C ->85°C, -2°C/second; 85°C ->25°C, -0.1°C/second, 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min.⁷⁸ (link) The template was cleaned up using a PCR clean-up column (Qiaquick) and the 120 bp product was verified on a 2% agarose gel. The sgRNA was transcribed from this DNA template using Ambion MEGAscript SP6 kit.⁷⁸ (link) 1 nl of a 1 μl of Cas9 mRNA (200 ng/μl) and 1 μl purified sgRNA (25 ng/μl) containing mixture were co-injected into one-cell stage embryos. Injected F0 embryos were raised to adulthood, fin-clipped and deep-sequenced by Illumina Sequencing (below).