Wild-type human EBC1 (EBC1/WT), NCI-H441, NCI-H1993, SNU-5, T47D, and HeLa cells were obtained from the ATCC, cultured in the manufacturer's recommended media up to passage 15–20, authenticated by short tandem repeat profiling and Mycoplasma tested in the last 1–3 years (IDEXX BioResearch).
EBC1/WT cells were engineered to stably express Cas9 nuclease by lentiviral infection (pLentiCas9-Blast) and selection with blasticidin (EBC1/Cas9). To generate EBC1/Cas9 cells stably knocked out for Rab11a and Rab5c, cells were plated in tissue culture-treated 12-well plates (Corning) at 200,000 cells/well. On day 2, cells were preincubated with 5 μg/mL polybrene for 30 minutes at 37°C and infected with lentiviruses (pLenti-H1-gRNA, Gentarget) for 24 hours at a multiplicity of infection of 4. Puromycin selection was initiated 2 days after infection. The lentiviruses encoded guide RNA against Rab11a (GCACAGATATGGGACACAGC, GAGTGATCTACGTCATCTCA or CATGTCTCCAAGCAACAATG), Rab5c (CAAGATCTGTCAATTTAAGC, TCCTCAGGATACATTTGCAC, TCCAGGCCGAAACCGAGGTG) or control (GTCTCCACGCGCAGTACATT). Knockout efficiency was determined by Western blot (WB) analysis and cells were used for experiments up to six passages after the beginning of selection or until an increase in the target expression was observed.
To generate EBC1 cells expressing endosomal markers, EBC1/WT cells were infected with the same protocol as above. The lentiviruses (Gentarget) encoded cDNA sequences of Rab5c (GenBank: U18420.1), Rab11a (GenBank: AF000231.1), or Rab7a (GenBank: AF050175.1), terminally fused to the N-terminus of GFP under the control of suCMV promoter. Puromycin selection was initiated 2 days after infection and cells were sorted for GFP-positive expression. To transciently knock down cathepsin-L in EBC1/WT, EBC1/Rab11a-GFP or EBC1/Rab5c-GFP, 10,000 cells were plated in collagen-coated, 96-well optical plates (Greiner #655956). Transfections were performed the next day with 5 pmol siRNA (Dharmacon #J-005841-11-0005; Invitrogen #4390824) and 0.25 μL Lipofectamine RNAiMax (Invitrogen) in a final volume of 100 μL Optimem (Invitrogen) per well. METxMET-VC-biosensor assays were performed 3 days posttransfection as described below and samples were lysed to determine cathepsin-L knockdown efficiency with WB analysis.