Optimizing Northern Blot Analysis for miRNA Detection

Total RNA from MCF-7 cells was loaded onto 15% SequaGel (National Diagnostics), electrophoresed and transferred to nylon membranes at 10–15 V (90 min) using Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad). Membranes were cross-linked to the RNA (60°C for 1–2 h) using freshly prepared cross-linking reagent (Doc-S). For ³²P-based blots, LNA–DNA mixed oligonucleotide probes were end-labeled with [γ-³²P] ATP by T4 polynucleotide kinase using KinaseMaxTM Kit (Ambion). For human miRNAs, pre-synthesized LNA-modified oligonucleotides were purchased from Exiqon (http://www.exiqon.com). For the KSHV miRNA, the probes were synthesized by Integrated DNA Technologies, IA. For LED blots, probes were labeled with the non-radioactive DIG, using End Tailing Kit (Roche Applied Science, Indianapolis, IN). Probe sequences used against the human miRNAs are TCAACATCAGTCTGATAAGCTA (miR-21), CGCCAATATTTACGTGCTGCTA (miR-16), TCCATCATTACCCGGCAGTATTA (miR-200c) and CAGACTCCGGTGGAATGAAGGA (miR-205). Pre-hybridization and hybridization were carried out using various hybridization buffers at different temperatures (Supplementary Table S1). For radioactive blots, hybridization buffers contained 10⁶ cpm/ml of probe. For both methods, after hybridization the membranes were washed (37°C) twice using a low stringency buffer solution (2× SSC, 0.1% SDS), and a high stringency buffer solution (0.1× SSC, 0.1% SDS), for five and ten minutes, respectively. During optimization of northern blot analysis, photoemissions were detected using ChemiDoc-IT Imaging System (Figures 1, 2, Supplementary Figures S2 and S4). Since ChemiDoc-IT system is not compatible with ³²P-based methods, to enable an unbiased comparison between the two methods (Figures 3 and 4), we used phosphor image screens to detect signals for both methods. To study the specificity of LED method, we used synthesized single-stranded kshv-miR-K12-1 and its mutants (M1, M2, M3) containing a 5′ phosphate to closely mimic miRNAs. The sequences are (mutations underlined): 5′-/Phos/AUUACAGAAACUGGGUGUAAGC-3′ (kshv-miR-K12-1), 5′-/Phos/AUUACAGAAACAGGGUGUAAGC-3′ (M1), 5′-/Phos/AUUACAGAAAGAGGGUGUAAGC-3′ (M2) and 5′-/Phos/AUUACAGAACGAGGGUGUAAGC-3′ (M3). The DNA-LNA mixed sequence (LNA underlined) 5′-GCTTACACCCAGTTTCCTGTAAT-3′ was used as the probe sequence against all four KSHV miRNA sequences. For specificity analysis, each lane in the gel (15% of polyacrylamide gel) was loaded with K12-1 synthetic RNA (0.2 fmol) mixed with MCF7 total RNA (5 µg). For sensitivity analysis, we used serially diluted amounts (0–0.4 fmol) of K12-1 miRNA that was spiked into MCF7 total RNA (5 µg).
Figure 1.

Effect of various hybridization buffers on the sensitivity of LED protocol in detecting miR-21 and miR-16. Seven different hybridization buffers (A–G) based on a probe concentration of 0.2 nM were used as indicated and detailed in supplementary document (Supplementary Table S1). Varying amounts of total RNA (3, 5 and 10 µg) were used to detect mature miR-21 and miR-16 (arrowheads) for each probe concentration, and the corresponding photo-luminescence was recorded over varying lengths (1, 3 and 5 min) of time. The upper bands may correspond to the precursor and primary transcripts of the miRNAs.

Figure 2.

Evaluation of four different nylon membranes for LED protocol. Duration of photo-exposure (1, 3 and 5 min) and amount of total RNA (3 and 6 µg) are indicated. Among the tested membranes (A–D), positively charged and neutral nylon membranes purchased from Roche (A) and GE Healthcare (B), yielded the strongest signals.