Measuring SARS-CoV-2 Frameshift Efficiency

The −1 PRF sequence from SARS-CoV-2 was inserted between the coding sequences of renilla luciferase (Rluc) and firefly luciferase (Fluc) to generate a pDual-SARS-CoV-2 plasmid (−1, WT). For the in-frame control reporter pDual-SARS-CoV-2 (0, Ctrl), an additional cytosine was inserted immediately after the silent mutated slippery sequence such that Fluc and Rluc were in the same reading frame (denoted as “0”)^{41 (link)}. The 33 nt sequence (GGTTATGGCTGTAGTTGTGATCAACTCCGCGAA) that could form a duplex with the Stem 1 region of FSE-PK were deleted by PCR using KOD hot-start high fidelity DNA polymerase (Merck Millipore, 71086) with primers shown in Supplementary Table 1. Frameshifting efficiency was measured by transient transfection of the Dual-Luciferase Reporter plasmids into 293T cells (ATCC, CRL-3216) using Lipofectamine 2000 as previously described^{77 (link)}. 293T cells were seeded in a 6-well plate at a density of 30%. On the following day, 0.2 μg of each plasmid were individually transfected into cells and allowed for further incubation of 24 h in a 5% CO₂ incubator. Luciferase activity was measured using a Dual-Luciferase Reporter Assay Kit by following the manufacturer’s instructions (Promega, E1910). We quantified the frameshifting efficiency by normalizing WT and Del values to their in-frame controls as previously described^{78 (link)}.