The lentiviruses were produced in HEK-293FT cells using plasmids sgRNA (MS2) (#61427; Addgene, Cambridge, MA, USA), dCas9-VP64 (#61425; Addgene, Cambridge, MA, USA), or MS2-P65-HSF1 (#61426; Addgene, Cambridge, MA, USA). The sgRNA sramble (SCR) was constructed with the sequence GCACTACCAGAGCTAACTCA and the sgRNA T2 with the sequence ACATTACAAGTTGCAAATCA, according to protocol established by Konermann et al. (30 (link)).
Transduction and cell selection were performed serially: dCas9-VP64 was selected with blasticidin; MS2-P65-HSF1 was selected with hygromycin; and sgRNA-SCR or sgRNA-T2 was selected with zeocin. The concentration of antibiotics used was determined through a dose–response curve. The cells were plated to reach 50% of confluency 48 h before transduction and maintained for 24 h with a solution (1:1) of viral supernatant in culture medium, followed by of antibiotic selection until control cells died.
Transduction and cell selection were performed serially: dCas9-VP64 was selected with blasticidin; MS2-P65-HSF1 was selected with hygromycin; and sgRNA-SCR or sgRNA-T2 was selected with zeocin. The concentration of antibiotics used was determined through a dose–response curve. The cells were plated to reach 50% of confluency 48 h before transduction and maintained for 24 h with a solution (1:1) of viral supernatant in culture medium, followed by of antibiotic selection until control cells died.
Free full text: Click here
