Recombinant proteins were produced using the following primer sequences (CppA: cppA_pET-F: 5’- CCGGATCCAATGACTTTAATGGAAAATATTAC -3’ cppA_pET-R: 5’ CCGGATCCTTCATTTCGTAAACCATACTTC 3’, HVR: emm_pET-F: 5’- CCGGATCCAGGTTTTGCGAATCAAACAGAGGTTAAG -3’, emm_pET-R: 5’- CCGGATCCTAGCTCTCTTAAAATCTCTTCCTGCAACTTCC -3’, Aur: aur_pET-F: 5’- CGGGATCCGATTGATTCAAAAAATAAACC -3’ aur_pET-R: 5’- CGGGATCCTTACTCCACGCCTACTTCATTC) and the pET-19b overexpression system as previously described [49 (link)]. rCppA, rEmm 1.0 hypervariable region (HVR), rAur and the previously described rScpA fragment [49 (link)], truncated at amino acid 720 to prevent pro-peptide removal, were purified using the Ni-NTA purification system (Invitrogen) according to the manufacturer's instructions. Purified proteins were buffer-exchanged into PBS. Full-length rScpA was expressed following amplification from gDNA (scpA_pET-F: 5’- CCGGATCCAACCAAAACCCCACAAACTC-3’, scpA_pET-R: 5’- CCGGATCCTAGAGTGGCCCTCCAATAGC-3’), and purified from BL21 cell lysates by size exclusion chromatography using a 1 × 50 cm Econo-Column® (Bio-Rad) packed with Sephadex G-100 (Pharmacia). PBS fractions containing ScpA were identified by SDS-PAGE, pooled and concentrated using a 30,000 MWCO spin column (Vivaspin, GE Healthcare).
Free full text: Click here