Analyzing OVA Expression in Lung Tissue

RNA was isolated out of lung biopsies of the right lung lobe using the RNeasy Minikit (Qiagen; Hilden, Germany). For reverse transcription, 2 µg RNA was used with RevertAid First Strand cDNA synthesis kit (ThermoScientific, Waltham, MA, USA), or Ready-To-Go You-Prime First-Strand Beads kit (GE; Boston, MA, USA). qRT-PCR was performed like described before (24 (link)). Primers specific for sense orientation of OVA expression cassette were used (AAGAGTCAAATGGCTCTCCTCAAGCGTATT and GTCTGTTGTGCCCAGTCATAGCCGAATAG). OVA expression was related to expression of lung tissue-specific surfactant protein C (Spc) gene (CACCATCGCTACCTTTTCCA and CTCGGAACCAGTATCATGCC). As indicated, in some experiments GAPDH was used as reference housekeeping gene [primers provided in RevertAid First Strand cDNA synthesis kit (ThermoScientific, Waltham, MA, USA)].