For ISH and immunostainings, fish were sacrificed, eyes dissected and fixed in 4% paraformaldehyde/ 0.1 M PBS after removal of the lens. Eyes were embedded in gelatin/sucrose and sectioned (14 µm) with a cryostat. The serpine3 in situ probe spans the coding exons 3–8 (transcript: ENSDART00000132915.2). Using primers with restriction enzyme cut sites (forward, Not1: TAAGCA GC GGCCGCGTAAAAGTGCCCATGATGTACCAG , reverse, BamHI: TAAGCA G GATCC ACAACTCGACCTATAAACAGCAAC ), serpine3 cDNA was amplified from total cDNA and cloned into the pCRII-topo vector (Invitrogen). The antisense probes were transcribed with SP6 polymerase, using a DIG-labeled NTP mix (Roche diagnostics). The (fluorescent) ISH were conducted as previously described with minor modifications (de Oliveira-Carlos et al., 2013 (link)): Hybridization and washing steps were performed at 60 °C. For chromogenic in situs, sections were incubated with anti-digoxigenin-AP (Roche), diluted 1:4000 in DIG-blocking reagent (Roche) at 4 °C overnight and subsequently developed with NBT/BCIP (Roche). For FISH, sections were washed in PBS immediately after quenching. Sections were blocked for 1 hr with 2% blocking reagent in MABT (Perkin-Elmer) and then incubated with anti-digoxigenin-POD (Roche), diluted 1:500. The signal was detected with the TSA Plus Cy3/Cy5 kit (Perkin-Elmer).
Free full text: Click here
