Labeling and Binding of Topoisomerase II

The labeling of 36-mer oligonucleotide 1(5′ATGAAATCTAACAATGCGCTCATCGT CATCCTCGGC3′) containing high-affinity topoisomerase II binding site was done using polynucleotide kinase (Roche Biochemicals). The labeled oligonucleotide 1 was annealed to oligonucleotide 2 (3′TACTTTAGATTGTTACGCGAGTAGCAGTAGGACCG5′) in a buffer containing 40 mmol/L Tris–HCl (pH 7.5), 20 mmol/L MgCl₂, and 50 mmol/L NaCl at 70°C for 1 h and allowed to cool down slowly to room temperature. Briefly, the reaction was done in a 20 μL binding buffer containing 50 mmol/L Tris– HCl (pH 7.5), 1 mmol/L DTT, 4 mmol/L MgCl₂, 50 mmol/L KCl, and 15 μg mL⁻¹ BSA and 5 pmol of 36 bp duplex oligonucleotide and LdTOPII enzyme and varying concentrations of JVPH3 and JVPH4. Reaction mixtures were incubated at 4°C for 30 min and electrophoresed through 7% nondenaturing polyacrylamide gel and autoradiographed (Sengupta et al. 2005b (link)).