ChIP Assay for p53 Binding Analysis

The ChIP assay performed in this study was adapted from previously reported methods and with assistance from members of the Oestreich laboratory [12 (link),19 (link)]. In brief, chromatin was harvested from GBM12, GBM14, and GBM22 cells and immunoprecipitated with 5 µg of antibodies to p53 (DO-1) (Santa Cruz sc-126X) or a mouse IgG control (Santa Cruz SC-2025). Roughly 10 ng/µL of precipitated DNA was analyzed with gene-specific primers (SLC7A11 forward: 5′- AGGCTTCTCATGTGGCTGAT -3′, and reverse, 5′- TGCATCGTGCTCTCAATTCT -3′; p21 forward: 5′- CTTTCACCATTCCCCTACCC -3′, and reverse. 5′- AATAGCCACCAGCCTCTTCT -3′; human control HSPA6 forward: 5′- AGGAGAGGACTTCGACAACCG -3′ and reverse, 5′- CAGGTCCTTCCCATGCTTCC -3′) by RT-PCR with GoTaq (Promega M7123), according to the manufacturer’s instructions and as previously detailed [12 (link)]. For each RT-PCR reaction, 10 ng of DNA was amplified and analyzed on a 1% agarose gel. Images were captured with the Azure c500 system (Dublin, CA, USA).