CRISPR/Cas9 Oligo Cloning for Zebrafish

For oligo cloning of sgRNA target sequences the previously published pDR274 vector was used^{27 (link)} (Addgene Plasmid #42250; sequences of primers used in this study are given in Table S1). For cas9 RNA synthesis the MLM3613^{27 (link)} (Addgene Plasmid #42251) or the pCS2-nCas9n vector^{28 (link)} (Addgene Plasmid #47929) were utilized. Both vectors were purchased from Addgene (www.addgene.org; Cambridge, USA). For designing and constructing of sgRNAs the open access ZiFit Targeter software (http://zifit.partners.org/ZiFiT/) was used. Specific target sites were identified by alignments of zebrafish and human sequences. sgRNA target site (GGATTCCAGGCCAGTTATGA) is located in exon 13 of fndc3a (ENSEMBL Zv9 Transcript: ENSDART00000097261) and targets the second Fibronectin type III domain, while sgRNA target site in exon 18 (GGCGTACAGTGGTTCGGCTC) targets the third Fibronectin type III domain.