Genotyping and Profiling Glioma Cell Lines

To characterize our mouse glioma cell lines, a genotyping PCR for Nf1 (primers: Nf1-wt-F: GGTATTGAATTGAAGCAC, Nf1-R: TTCAATACCTGCCCAAGG, Nf1-mut-F: ATTCGCCAATGACAAGAC) and Tp53 (primers: Tp53-wt-F: AGGCTTAGAGGTGCAAGCTG, Tp53-R: TGGATGGTGGTATACTCAGAGC, Tp53-mut-F: CAGCCTCTGTTCCACATACACT) was performed [11 (link)]. The reported ATRX mutation (E2281*, PCR primers: GAACATGATTCTCTTTTGGACCAC and ACCTGTTTCAAATGTGACCCTTT and sequencing primer GGATACCATACTTGCAGAGC) and NF1 mutation (p.LF1247fs18*, primers: AATAAAAATGGGATTGTTTG and GGAAGAGAGTCTGCATGGAG) in the TM-31 cell line was confirmed by sequencing. Western blot was performed to evaluate the expression of OPC lineage markers and for the expression of TP53 and CDKN2A in TM-31. Target inhibition of the drugs that caused potent cell death in our glioma lines inhibited was evaluated by western blot as well. Glioma cell line 17 was treated for 24h with 20nM Trametinib, 1μM GDC-0941, 5nM bortezomib, 25nM Dinaciclib, 500nM JQ1, 100nM LY2606368, 500nM PTC596, or 1μM Vorinostat and target inhibition was evaluated by comparing the expression levels of pERK, pAKT, Ubiquitin, pS2 RNApol II and CDK9, MYC, pCHEK1, BMI1 and H3K27Ac respectively.