Generation of Tbx5 and Isl1 Knockout ESC Lines

For the generation of Tbx5 KO vector, sgRNAs were designed with the CRISPR design tool, Benchling (www.benchling.com). In case of Isl1, sgRNAs were used as described previously^{33 (link)}. The used sequences of sgRNAs are as follows: Tbx5 sgRNA1: 5′CGAAACCTGAGAGTGCTCTG, Tbx5 sgRNA2: 5′CAAGTCTCCATCATCCCCGC, Isl1 sgRNA1: 5′CCGATTTAAGCCGGCGGAGT, and Isl1 sgRNA2: 5′TCATGAGCGCATCTGGCCGA. Each sgRNA was annealed and inserted into the pGuide-it-ZsGreen1 Vector (Guide-it CRISPR/Cas9 system (Green), Clontech) as per the manufacturer’s protocol. Both of pGuide-it-ZsGreen1-sgRNA1 and -sgRNA2 for each gene were transfected to wild-type (WT) B6 ES cells by electroporation using Super electroporator NEPA 21 typeII (NEPA GENE). To subclone KO cell lines, GFP-positive ES colonies were randomly picked and propagated. All subclones were investigated for their mutations using Guide-it mutation detection kit (Clontech). Six lines of Tbx5 KO ESC lines and six lines of Isl1 KO ESC lines were established and each of the three KO ESC lines were used for the generation of heart organoids with FGF4 on LN/ET complex.