Cas9 was inserted upstream of GAPDH, by CRISPR-mediated homology-directed repair as previously described15 . Several clones were tested, and one was selected for all experiments, based on its Cas9-editing efficiency. Editing efficiency was assessed by transducing d4 neurons with a lentiviral vector encoding BFP, GFP and a sgRNA for GFP. Neurons were dissociated on d8 and subjected to flow cytometry using CytoFLEX S (Beckman Coulter). Editing efficiency was calculated by comparing the percentage of BFP+/GFP- (edited) to BFP+/GFP+ (total transduced) cells using FlowJo version 10.8.1 Software for macOS (BD Life Sciences).
Tag-RFP was inserted downstream of CHOP, separated by a T2A as described previously15 . The following sgRNA sequence was used: 5ʹ-UGCUCCCAAUUGUUCAUGCU-3ʹ (Merck). Several clones were genotyped by PCR (primers: TATCTTCATACATCACCACACCTGA and TTCTAAAACACATCAGAGATTGGGG) and Sanger sequencing. Validation experiments were performed with two homozygote (518/535) and two heterozygote (403/407) clonal lines. All other experiments were performed with both homozygote lines.
Tag-RFP was inserted downstream of CHOP, separated by a T2A as described previously15 . The following sgRNA sequence was used: 5ʹ-UGCUCCCAAUUGUUCAUGCU-3ʹ (Merck). Several clones were genotyped by PCR (primers: TATCTTCATACATCACCACACCTGA and TTCTAAAACACATCAGAGATTGGGG) and Sanger sequencing. Validation experiments were performed with two homozygote (518/535) and two heterozygote (403/407) clonal lines. All other experiments were performed with both homozygote lines.
Free full text: Click here
