Zebrafish embryos were fixed in 4% PFA at the desired developmental stages. Alkaline Phosphatase based colorimetric whole mount in situ hybridization (WISH) was performed as previously described62 (link),63 (link). Digoxygenin (DIG) labeled antisense riboprobes were in vitro transcribed from linearized plasmids along with DIG labeling mix (Roche). The following DIG labeled antisense riboprobes were used: crhb21 (link), dkk129 (link), fzd8a64 (link), fzd8b64 (link), otpa22 (link), sfrp547 (link), neurog165 (link), sim1a21 (link), th62 (link), uts136 (link), vip36 (link) and wnt8b66 (link).
A 992 bp cDNA fragment of axin2 (NCBI GenBank AF387812) was amplified by RT-PCR using RNA isolated from WT zebrafish embryos at 24 hpf. For PCR amplification the following primers were used: axin2 forward primer 5′GGAGAGGAGGTGAACATGGA3′ and axin2 reverse primer 5′ATCATCACGAATGCTGGTCA3′. The amplified axin2 cDNA fragment was cloned into the pCRII-TOPO vector (Invitrogen). For synthesis of a DIG-labeled antisense riboprobe, the pCRII-axin2 vector was linearized with XhoI (NEB) and in-vitro transcribed with a SP6 RNA polymerase (Roche).
Tyramide signal amplification (TSA)-based fluorescent in situ hybridization (FISH) for wnt8b, sox267 (link) or sox367 (link) combined with fluorescent immunohistochemistry for Tyrosine Hydroxylase (TH) or Sox2 was performed as described68 (link).
A 992 bp cDNA fragment of axin2 (NCBI GenBank AF387812) was amplified by RT-PCR using RNA isolated from WT zebrafish embryos at 24 hpf. For PCR amplification the following primers were used: axin2 forward primer 5′GGAGAGGAGGTGAACATGGA3′ and axin2 reverse primer 5′ATCATCACGAATGCTGGTCA3′. The amplified axin2 cDNA fragment was cloned into the pCRII-TOPO vector (Invitrogen). For synthesis of a DIG-labeled antisense riboprobe, the pCRII-axin2 vector was linearized with XhoI (NEB) and in-vitro transcribed with a SP6 RNA polymerase (Roche).
Tyramide signal amplification (TSA)-based fluorescent in situ hybridization (FISH) for wnt8b, sox267 (link) or sox367 (link) combined with fluorescent immunohistochemistry for Tyrosine Hydroxylase (TH) or Sox2 was performed as described68 (link).
Free full text: Click here
