HEK293T ATG5 KO cells were generated by genomic knock out using CRISPR Cas9. To this end, 3rd generation lentiviral vectors were generated as described before65 using pSicoR-CRISPR-PuroR CRISPR/Cas966 (link) constructs harbouring an ATG5 targeting sgRNA or a non-targeting (NT) sgRNA. (NT: ACGGAGGCTAAGCGTCGCAA, ATG5: AACTTGTTTCACGCTATATC)67 (link) as the transfer plasmid. HEK293T cells were transduced with the lentiviral vectors and 3 days post-transduction separated into individual cells using limited dilution. The individual cells were grown into clonal cell lines and screened for ATG5 KO using Western blot analysis (anti-ATG5 antibody, Cell Signaling Technology, #2630). Clones with a conformed knock out were expanded and stocks were conserved by cryo preservation.
Anti antibodyCell linesCells Clones Crispr Cryo preservation Dilution Genomic Plasmid Vectors Western blot analysis
Corresponding Organization : MRC Institute of Genetics and Molecular Medicine
Other organizations :
Universität Ulm, Université Paris Cité, Inserm, Institut des Maladies Génétiques Imagine, Technical University of Munich, Istituto Giannina Gaslini, Istituti di Ricovero e Cura a Carattere Scientifico, Children's Health Ireland at Crumlin, St Olav's University Hospital, Haukeland University Hospital, University of California, Davis, Rady Children's Hospital-San Diego, Children’s Institute
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
