Molecular Diagnosis of Plasmodium Species

The reference molecular diagnosis was performed by real-time PCR using a Light Cycler 2.0 (Roche Group, Rotkreuz, Switzerland) to identify four human Plasmodium species (with the exception of P. knowlewsi), as previously described [7 (link)]. The primers and probes used were presented in Table 2. Briefly, DNA was extracted from 200 µL of whole blood using the QIAamp^® DNA Blood Mini kit, according to the manufacturer’s recommendations (Qiagen, Hilden, Germany). Each parasite species was detected by an individual real-time PCR targeting a specific gene for each of the four human Plasmodium species using the Light Cycler^® TaqMan^® Master Mix (Roche Group, Switzerland). For each PCR run, two negative controls (ultra-pure water and human DNA) and one positive control (specific DNA from each species) were used.
Homemade real-time PCR tests, targeting the 18S rRNA gene, were performed to differentiate P. ovale wallikeri from P. ovale curtisi using Plasmo1_F (5′ GTTAAGGGAGTGAAGACGATCAGA 3′) and Plasmo2_R (5′ AACCCAAAGACTTTGATTTCTCATAA 3′) primers, as previously described [8 (link)].