Efficient Production and Delivery of dsRNA

For production of dsRNA to CeCENP-C (ggaaatgtacggagcgaaaa, acattgttggtgggtccaat) and CeINCENP (ggatgaaagagctcgagaagaa, ttctgacattctcacggacaac) the primers in parentheses with tails containing T3 and T7 promoters were used to amplify regions from genomic N2 DNA and the cDNA yk329a11, respectively. PCR reactions were cleaned (QIAGEN GmbH) and used as templates for 25 μl T3 and T7 transcription reactions (Ambion), which were combined and cleaned using an RNeasy kit (QIAGEN). RNA eluted with 50 μl of H₂O was mixed with 25 μl of 3× injection buffer (IX = 20 mM KPO₄, pH 7.5, 3 mM K-Citrate, pH 7.5, 2% PEG 6000) and annealed by incubating at 68°C for 10 min followed by 37°C for 30 min. DsRNA for CeCENP-A was made similarly, except cDNA yk325d10 digested with EcoRI (XhoI) was used to template the T7 (T3) reactions. For fixed assays, adult wild-type hermaphrodites injected with dsRNA were placed at 20°C for 24 h before fixation. For live fluorescence assays, young roller adults were injected and kept at 24.5°C for 22–30 h.