Profiling Immune Responses to Nucleic Acids
Corresponding Organization : Instituut voor Tropische Geneeskunde
Variable analysis
- Plasmid expressing EF1α promoter-driven Cas9-NLS-2A-EGFP and U6-driven guide RNA targeting BATF2 [CGGGTTCCTGTTACCCAGCTC]
- Stimulations with herring testes DNA (dsDNA), 3pdsRNA, 9.2s RNA, Pam3CysK4, ultrapure LPS, flagellin, R848, and CpG2216
- Cellular supernatants probed for IFN-α, IFN-β, TNF, IL-12p40, CXCL10, IL-8, IL-6, and IL-23
- RNA isolated for analysis
- Buffy coats used to prepare PBMCs
- THP-1 cells used
- None specified
- None specified
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!