Profiling Immune Responses to Nucleic Acids

PBMCs were prepared from buffy coats by density gradient centrifugation, as previously described [21 (link)]. THP-1 cells were electroporated with a plasmid expressing EF1α promoter-driven Cas9-NLS-2A-EGFP and U6-driven guide RNA targeting BATF2 [CGGGTTCCTGTTACCCAGCTC], sorted for eGFP-positive cells, and selected via limited dilution, as previously described [22 (link)]. Genotypes were validated by Sanger sequencing (Figure S1). PBMCs and THP-1 cells were stimulated with herring testes DNA (dsDNA; Sigma-Aldrich/Merck, Darmstadt, Germany), 3pdsRNA, generated by in vitro transcription, as previously described [23 (link)], 9.2s RNA (Biomers, Ulm, Germany), Pam3CysK4, ultrapure LPS, flagellin, R848, and CpG2216 (all from InvivoGen, Toulouse, France), as indicated. Prior to stimulation, dsDNA and 3pdsRNA were complexed with Lipofectamine 2000 (Invitrogen/Thermo Scientific, Waltham, MA, USA), and 9.2 s RNA was complexed with poly-L-Arginin (Sigma-Aldrich/Merck, Darmstadt, Germany). Cellular supernatants were then harvested for ELISA probing for IFN-α, IFN-β (Hölzel Diagnostika, Cologne, Germany), TNF, IL-12p40, CXCL10, IL-8, IL-6 (BD Biosciences, Franklin Lakes, NJ, USA), and IL-23 (Human IL-23 HTRF Kit, CisBio, Codolet, France). RNA was isolated, as previously described [24 (link)].