Genotyping of MC4R-deficient Rats

The MC4R-deficient rat model was originally developed by an ENU-induced mutation in Wistar Hannover rats, which resulted in a truncated form of the receptor with the inability to be expressed in the plasma membrane ^{26 (link)}. The mutation introduced an additional Ddel restriction site (CTNAG) within the MC4R gene. Thus, genotyping was performed using a restriction enzyme-based PCR assay utilizing the primers: Forward: TGATCATGTGTAACGCTGTCAT, Reverse: TGACAAATTCTGCAGGTCTCT to amplify 177 bp fragment of Mc4r gene. The PCR product was subjected to DdeI enzyme restriction and genotyping was performed using Qiagen QIAxcel Advanced capillary electrophoresis system. For wild-type rats, Ddel treated PCR fragment generated 2 bands at 120 and 57 bases and homozygous MC4R deficient rats gave 3 fragments at 106, 56, and 15 (unobserved).