Generating SARS-CoV-2 Spike Pseudoviruses for Research

Pseudoviruses containing SARS-CoV-2 variant S protein and the backbone of deficient vesicular stomatitis virus (VSV) vector (VSV-ΔG-GFP) (BrainVTA) were generated using the previously described protocols^{47 (link),48} . In brief, 30 μg of S plasmid with a C terminal 18 amino acids truncation was transfected into HEK293T cells cultured in a 10 cm dish, then after 24 h the VSV-ΔG-GFP pseudoviruses were added into the cell supernatant. The inoculum was then removed following incubation at 37 °C for 2 h and the cells were washed with PBS and cultured in DMEM supplemented with both 10% FBS and anti-VSV-G antibody (produced by I1Hybridoma ATCC^® CRL2700™). Then 20 h post-infection, the supernatants were harvested, filtered (0.45 μm filter, Millipore, Cat#SLHP033RB), aliquoted, and stored at −80 °C.
Prior to quantification, the unpackaged RNA in the SARS-CoV-2 pseudoviruses was removed using a 0.5 U/μL BaseMuncher endonuclease (Abcam) treatment at 37 °C for 1.5 h. Viral RNA was extracted using an RNA extraction kit (Bioer Technology) and quantified using a quantitative RT-PCR assay performed using a 7500 Fast Real-Time PCR system (Applied Biosystems). The primers and probe used to detect the L gene of the VSV virus are as described in the literature^{49 (link)}: VSV-F: TGATACAGTACAATTATTTTGGGAC; VSV-R: GAGACTTTCTGTTACGGGATCTGG; VSV-probe: FAM-ATGATGCATGATCCWGC-TAMRA.