Multiplex Real-Time PCR for Culex Mosquito Identification

Mosquitoes collected at the various study sites were frozen at −70°C and transported to the laboratory where they were first identified morphologically at the genus level [13] . Subsequently, Culex ssp. from individual collections were pooled to up to 25 specimens per pool. All pooled samples were placed in sterile 2-mL cryovials, and subsequently maintained at −70°C until being assayed. Each mosquito pool was triturated in 500 µL of cell culture medium (high glucose Dulbecco's modified Eagle's medium (Sigma-Aldrich) with 10% heat-inactivated fetal bovine serum, 100 U/mL penicillin, 100 µg/mL streptomycin, and 2.5 µg/mL amphotericin B using two stainless steel beads (5 mm; Qiagen) in a TissueLyser (Qiagen) for 2 min at 50 oscillation/s. The suspensions were clarified by centrifugation (5,000× g for 1 min), and the supernatant was used for DNA extraction with AquaGenomic™-Solution (protocol for Drosophila samples, MultiTarget Pharmaceuticals) or QIAamp viral RNA mini kit according to the manufacturer's instructions.
The extracted DNA was analyzed by a newly designed multiplex real-time PCR using the primers for Culex pipiens F (5′- GCGGCCAAATATTGAGACTT -3′; nucleotide [nt] position 3 to 22 [the nt positions are given according to the numbering in the Culex reference strain 258c, GenBank accession number gb/DQ470148.1) and Cx. pipiens R (5′- CGTCCTCAAACATCCAGACA -3′; nt position 146 to 165) and probes Cx. pipiens all (5′- Cy55- GGAACATGTTGAGCTTCGGK -BBQ-1 -3′; nt position 77 to 95), Cx. pipiens pipiens biotype pipiens (5′- JOE GCTTCGGTGAAGGTTTGTGT-BHQ1 –3′) nt position 89 to 108 and Cx. pipiens pipiens biotype molestus (5′- Rox- TGAACCCTCCAGTAAGGTATCAACTAC- BHQ2 -3′; nt position 41 to 67; Reference strain 284b, GenBank accession number gb/470150.1) of the microsatelite locus CQ11. Cx. torrentium DNA was detected using the primers Cx. torrentium F (5′ -GACACAGGACGACAGAAA -3′; nt position 86 to 103), Cx. torrentium R (5′- GCCTACGCAACTACTAAA -3′; nt position 363 to 380) and the probe Cx. torrentium (5′- FAM- CGATGATGCCTGTGCTACCA-BHQ1 -3′; nt position 112 to 131) of the ace2 gene (Cx. torrentium reference strain, GenBank accession number gb/AY497525.1). Multiplex real-time PCR was performed in a 20 µL reaction volume using HotStarTaq® Master Mix Kit according to the manufacturer's protocol (Qiagen). The specific primer molarities and sequence alignments of the loci used for primer design are shown in Figure S1.