The qPCR reactions were performed in a total volume of 30 μl containing 2.3 μl of 20 mg/ml bovine serum albumin (BSA; Sigma A2153), 15.05 μl of SensiFAST Probe Lo-ROX Mix (Bioline BIO84005), 3.05 μl of forward primer (5 pmol/μl), 3.05 μl of reverse primer (5 pmol/μl), 1.55 μl of TaqMan probe (5 pmol/μl), and 5 μl of DNA extract. The primers and probes used were as follows:
For B. anthracis, the chromosomal marker targeting prophage lambdaBa03 (PL3; Weigel et al., 2010 (link)), PL3_F: AA AGCTACAAACTCTGAAATTTGTAAATTG, PL3_R: CAACG ATGATTGGAGATAGAGTATTCTTT, and Tqpro_PL3: FAM- AACAGTACGTTTCACTGGAGCAAAATCAA-BHQ-1. For Y. pestis, the gene capR encoding the Lon ATP-dependent serine protease (Steinberger-Levy et al., 2016 (link)), capF: GGATT ACGATCTCTCGGATGTGA, capR: AGCCGGACAGACGAAT AACTTC, and Taq-CapR: FAM-TTGTGGCGACCTCTAAC TCCATGAATATTCC-BHQ-1. For F. tularensis, the gene fopA encoding an outer membrane protein (Versage et al., 2003 (link)), fopAF: ATCTAGCAGGTCAAGCAACAGGT, fopAR: GTCAACACTTGCTTGAACATTTCTAGATA, and fopAP: FA M-CAAACTTAAGACCACCACCCACATCCCAA-BHQ-1. The PCR thermal conditions were as follows: 3 min at 60°C followed by 40 cycles of 15 s at 95°C and 35 s at 60°C.
For B. anthracis, the chromosomal marker targeting prophage lambdaBa03 (PL3; Weigel et al., 2010 (link)), PL3_F: AA AGCTACAAACTCTGAAATTTGTAAATTG, PL3_R: CAACG ATGATTGGAGATAGAGTATTCTTT, and Tqpro_PL3: FAM- AACAGTACGTTTCACTGGAGCAAAATCAA-BHQ-1. For Y. pestis, the gene capR encoding the Lon ATP-dependent serine protease (Steinberger-Levy et al., 2016 (link)), capF: GGATT ACGATCTCTCGGATGTGA, capR: AGCCGGACAGACGAAT AACTTC, and Taq-CapR: FAM-TTGTGGCGACCTCTAAC TCCATGAATATTCC-BHQ-1. For F. tularensis, the gene fopA encoding an outer membrane protein (Versage et al., 2003 (link)), fopAF: ATCTAGCAGGTCAAGCAACAGGT, fopAR: GTCAACACTTGCTTGAACATTTCTAGATA, and fopAP: FA M-CAAACTTAAGACCACCACCCACATCCCAA-BHQ-1. The PCR thermal conditions were as follows: 3 min at 60°C followed by 40 cycles of 15 s at 95°C and 35 s at 60°C.
Free full text: Click here
