The full length of the bacterial 16S rRNA gene was amplified using the primers 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 1492R (5′‐TACGGYTACCTTGTTACGACTT‐3′) at an annealing temperature of 51°C
32 (link). The PCR mixtures contained 12.5 μl 2× Taq PCR Mix (Sangon), 0.2 μM forward primers, 0.2 μM reverse primers, and 10 ng template, brought up to a final volume of 25 μl with ddH2O. The amplification products were visualized by electrophoresis on 1.0% agarose gels and purified with the Gel Advance gel extraction system (Viogene). Then, the purified products were cloned into the pUCmT Vector and transformed into E. coli XL1‐Blue for growth. Clones were randomly screened from each single‐cell sample and sequenced using an ABI Prism 3100 genetic analyzer system (Applied Biosystems).
The quality of each sequence was checked by the Phred/Phrap program
33 (link). High‐quality sequences were compared with the NCBI public nucleotide database using BblastN software (https://blast.ncbi.nlm.nih.gov/Blast.cgi ) to obtain the approximate taxonomic identification of the single bacterium. The sequences have been submitted in GenBank, with accession numbers OP090257–OP090315.
32 (link). The PCR mixtures contained 12.5 μl 2× Taq PCR Mix (Sangon), 0.2 μM forward primers, 0.2 μM reverse primers, and 10 ng template, brought up to a final volume of 25 μl with ddH2O. The amplification products were visualized by electrophoresis on 1.0% agarose gels and purified with the Gel Advance gel extraction system (Viogene). Then, the purified products were cloned into the pUCmT Vector and transformed into E. coli XL1‐Blue for growth. Clones were randomly screened from each single‐cell sample and sequenced using an ABI Prism 3100 genetic analyzer system (Applied Biosystems).
The quality of each sequence was checked by the Phred/Phrap program
33 (link). High‐quality sequences were compared with the NCBI public nucleotide database using BblastN software (
Free full text: Click here
