Chromosomal Gene Deletion in E. coli

The method described by Datsenko and Wanner was used for chromosomal gene deletion (20 (link)). In brief, the genetic fragment containing the kanamycin resistance gene aph flanked by FLP Recognition Target (FRT) sites was amplified by PCR using the template plasmid pKD4 and the hybrid primers LBMAF:5′-GGCAG ATCCCGATTAGCGCCGCGCGTTTCTGGTCGTTGGATTTCCGTGTAGGCTGGAGCTGCTTC-3′ and LBMAR: 5′-CTCGCGTACCGTAGGCGGCGTCGCGCGCGTGGCATCGTCTTCACCCATATGAATATCCTCCTTAG-3′, which consisted of 20 nucleotides (nt) of the helper plasmid pKD4 and 45 nt on the 5′ and 3′ ends of the inactivated sbmA. The PCR fragment (1,567 bp) was purified, digested with DpnI, repurified and transferred into E. coli ATCC 25922 by electroporation, in which the Red recombinase expression plasmid pKD46 was previously transformed and induced by L-arabinose. Transformants were selected on Luria-Bertani (LB) agar containing 50 μg/ml of kanamycin at 37°C. The inserted sequence was amplified from the kanamycin-resistant strains by using the primers SBMF: 5′-GCACGGCAGAAAAAAGCA-3′ and SBMR: 5′-GACGGAAACAGCAAGAACAAA-3′ which is located outside of inactivated gene. The length of the PCR product of sbmA using the primers set SBMF and SBMR in E. coli ATCC 25922 is 1,404 bp. When sbmA is successfully inactivated, the PCR product (2,198 bp) was amplified and sequenced for the verification of the gene deletion.