Tick Identity Confirmation by Molecular Methods

In the laboratory, tick identity was confirmed by molecular methods. We extracted DNA from at least five specimens from each den using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany). PCR was performed on the rrs locus as previously described with the following primer pairs 16s + 1: CTGCTCAATGATTTTTTAAATTGC and 16s-1: CCGGTCTGAACTCAGATCATGTA [6 (link),9 (link)]. Amplicons were Sanger sequenced by GeneWiz (South Plainfield, New Jersey, USA) and the data were assembled and trimmed using Vector NTI software (Life Technologies, Carlsbad, CA, USA).

Free full text: Click here

Bermúdez S.E., Armstrong B.A., Domínguez L., Krishnavajhala A., Kneubehl A.R., Gunter S.M., Replogle A., Petersen J.M, & Lopez J.E. (2021). Isolation and genetic characterization of a relapsing fever spirochete isolated from Ornithodoros puertoricensis collected in central Panama. PLoS Neglected Tropical Diseases, 15(8), e0009642.

Publication 2021

DNeasy Blood & Tissue kit Vector NTI software

Blood Primer Tick Tissue Vector

Corresponding Organization : Centers for Disease Control and Prevention

Top 5 similar protocols

Variable analysis

independent variables

Extraction of DNA from at least five specimens from each den using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany)

dependent variables

Confirmation of tick identity by molecular methods

control variables

Not explicitly mentioned

controls

No positive or negative controls were explicitly mentioned in the provided information.

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!