Genetic Profiling of Vasculitis Patients

All included patients had available DNA samples. Affymetrix Axiom Biobank Genotyping Array was used for genotyping 286 patients as part of the Vasculitis Clinical Research Consortium GWAS (2 (link)). An additional 115 patients and 130 healthy controls were genotyped by PCR (including confirmation of 15 of the GWAS patients), via amplification of the SNP-containing region using forward primer 5′ GAGCTGACTCATGGCTGAAACCAAC 3′, reverse primer 5′ TGATGTGTATTAAAGAACTAGAGCT 3′. PCR products were separated by agarose gel electrophoresis and imaged using iBright FL1000 (Invitrogen, Thermo Fisher Scientific) (Supplemental Figure 1).