Identifying Tumor-Driving Chromosomal Aberrations

For neuroblastoma tumors, chromosomal regions with aberrations in copy numbers were identified through SNP array. SNP array copy number profiling and analysis of regions of homozygosity were performed according to standard procedures using the CytoSNP-850 K BeadChip (Illumina, San Diego, CA). Visualizations of SNP array results and data analysis were performed using NxClinical software (BioDiscovery, Los Angeles, CA), using Human genome build February 2009 GRCh37/hg1. Chromosomal aberrations that are known to be tumor driving or associated with high- risk disease were preferentially selected for TLA/TLC breakpoint identification (e.g. chromosome 1p, 1q, 2p (including MYCN locus), 3p, 11q, 17q) (4 (link)). The fusion partners of FOXO1 in the fusion-positive alveolar rhabdomyosarcomas were validated through RT-qPCR on tumor organoid models (tumoroids) grown from primary tumor material, as described previously (28 (link)). In the Ewing sarcoma sample, the fusion between EWSR1 and FLI1 was validated through RT-qPCR on the tumoroid with primers located on EWSR1 exon 8 (AGGAGAGAACCGGAGCATGA) and FLI1 exon 5 (CCCTGAGGTAACTGAGGTGTG).