siRNA Transfection Protocols for DNA Repair Genes

siRNAs were transfected using Lipofetamine RNAiMAX as per manufacturer’s instructions (Invitrogen). The All-Star negative control (siNS) siRNA was used as a control (Qiagen). The following siRNA sequences were used in this study.
siRAD51 5′ GACUGCCAGGAUAAAGCUU was used in a previous study^{61 (link)}.
siDNA2 5′ CAGUAUCUCCUCUAGCUAG was used in a previous study^{6 (link)}.
siFANCD2 5′ CAGAGUUUGCUUCACUCUCUA was used in a previous study^{62 (link)}siMUS81 5′ CAGCCCUGGUGGAUCGAUA was used in a previous study^{63 (link)}.
siFBH1 5′ GGAUGUUUGCAAGAGAGUCAGGAAA.

Free full text: Click here

Mason J.M., Chan Y.L., Weichselbaum R.W, & Bishop D.K. (2019). Non-enzymatic roles of human RAD51 at stalled replication forks. Nature Communications, 10, 4410.

Publication 2019

Lipofetamine RNAiMAX

Sirna

Corresponding Organization :

Other organizations : University of Chicago

Top 5 similar protocols

Variable analysis

independent variables

SiRAD51
SiDNA2
SiFANCD2
SiMUS81
SiFBH1

dependent variables

Not explicitly mentioned

control variables

Not explicitly mentioned

controls

Positive control: All-Star negative control (siNS) siRNA

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!