Total RNA was isolated from cells using TRIzol reagent (TaKaRa). Reverse transcription was performed using the PrimeScript™ RT Reagent Kit (TaKaRa) and gDNA Eraser (Perfect Real Time) according to the manufacturers’ instructions. Quantitative real-time PCR (qPCR) was performed using the SYBR Premix Ex Taq (Tli RNase H Plus) system on an ABI Step One Plus machine (Applied Biosystems). The experiments were performed in triplicate, and the values were normalized to that of GAPDH. For absolute qPCR, the standard curves were generated using coding regions of SNAI1, SNAI2 and JUNB as described by Denzler et al. (22 (link)). The primer sequences are as follows: ETS2 qPCR fwd, CCCCTGTGGCTAACAGTTACA; ETS2 qPCR rev, AGGTAGCTTTTAAGGCTTGACTC; HNF4A qPCR fwd, CACGGGCAAACACTACGGT; HNF4A qPCR rev, TTGACCTTCGAGTGCTGATCC; JUNB qPCR fwd, ACAAACTCCTGAAACCGAGCC; JUNB qPCR rev, CGAGCCCTGACCAGAAAAGTA; FOXP1 qPCR fwd, TGGCATCTCATAAACCATCAGC; FOXP1 qPCR rev, GGTCCACTCATCTTCGTCTCAG; CDH1 qPCR fwd, TCAGGCGTCTGTAGAGGCTT; CDH1 qPCR rev, ATGCACATCCTTCGATAAGACTG; CDH2 qPCR fwd, ACAGTGGCCACCTACAAAGG; CDH2 qPCR rev, CCGAGATGGGGTTGATAATG; SNAI1 qPCR fwd, GGCCCACCTCCAGACCCACT; SNAI1 qPCR rev, GCGGGGACATCCTGAGCAGC; SNAI2 qPCR fwd, TGTGACAAGGAATATGTGAGCC; SNAI2 qPCR rev, TGAGCCCTCAGATTTGACCTG; GAPDH qPCR fwd, GAGTCAACGGATTTGGTCGT; GAPDH qPCR rev, GATCTCGCTCCTGGAAGATG.
Protocol detail
Quantitative Real-Time PCR Analysis of Epithelial-Mesenchymal Transition Genes
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : Shanghai Advanced Research Institute, University of Chinese Academy of Sciences, Chinese Academy of Sciences, Shanghai Institutes for Biological Sciences, Center for Excellence in Molecular Cell Science, Shanghai University, Shanghai Institute of Materia Medica, ShanghaiTech University
Top 5 similar protocols
Variable analysis
independent variables
- None explicitly mentioned
- Relative expression levels of the following genes: ETS2, HNF4A, JUNB, FOXP1, CDH1, CDH2, SNAI1, SNAI2
- GAPDH gene expression for normalization
- Positive control: Standard curves generated using coding regions of SNAI1, SNAI2 and JUNB genes as described in the referenced publication.
- Negative control: Not explicitly mentioned
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!