Swabs were enriched 18–24 h at 37°C in 5 ml of Mueller Hinton broth (Sigma-Aldrich, U.S.A.) containing 6.5% NaCl. A 10 μl loopful of broth was plated both onto Brilliance™ MRSA2 agar (Oxoid, UK) and SaSelect™ agar (Bio-Rad, U.S.A) followed by incubation for 24 h at 37°C. One presumptive MRSA colony on Brilliance™ and up to three (if present) presumptive S. aureus colonies on SaSelect™ were sub-cultured onto blood agar. In order to increase the chance of detecting diversity, morphologically distinct colonies were chosen for sub-culturing from the SaSelect™ agar plates when possible. If no presumptive S. aureus was visible on SaSelect™ plates, these were then incubated for another 24 h. Isolates were tested by matrix-assisted laser desorption/ionization time-of-flight mass spectrophotometry (MALDI-TOF MS) (BioMérieux, France) for species confirmation. Confirmed S. aureus isolates were stored at −80°C for further analysis.
A multiplex PCR assay was performed to detect (i) spa encoding the staphylococcal protein A (Kahl et al., 2005 (link)), (ii) mecA and mecC encoding methicillin resistance (Oliveira and de Lencastre, 2002 (link); Stegger et al., 2012 (link)), (iii) scn, a marker of IEC encoding staphylococcal complement inhibitor protein (scn-F1: 5′TACTTGCGGGAACTTTAGCAA3′ and scn-R1: 5′AATTCATTAGCTAACTTTTCGTTTTGA3′, amplicon size: 130 bp), (iv) the CC398-specific sau1-hsdS1 variant (Stegger et al., 2011 (link)) using a newly designed forward primer FP2sau1: 5′GAGAATGATTTTGTTTATAACCCTAG3′ (amplicon size 106 bp), and (v) lukF-PV, a marker of the Panton-Valentine leucocidin (PVL) (Deurenberg et al., 2004 (link)). The PCR reactions were carried out in a final volume of 13 μl containing 1 × Qiagen Multiplex PCR Master Mix (Qiagen, Germany), 2 μM of each primer, and 1 μl of bacterial DNA. The following PCR conditions were used: initial denaturation at 94°C for 15 min, followed by 25 cycles consisting of denaturation (94°C for 30 s), annealing (59°C for 60 s), and extension (72°C for 60 s), and a final extension step at 72°C for 10 min. All S. aureus isolates were spa-typed as described previously (Harmsen et al., 2003 (link)). BURP cluster analysis of the spa types was performed in the Ridom StaphType software (Ridom GmbH, Germany) using default settings to deduce likely multi-locus sequence types of methicillin-susceptible S. aureus (MSSA) isolates. The staphylococcal cassette chromosome mec (SCCmec) types and subtypes were determined by PCR for all CC398 isolates (Larsen et al., 2016a (link)). The IEC type was determined by the presence of the scn, chp, sak, sea, and sep genes (van Wamel et al., 2006 (link)).
A multiplex PCR assay was performed to detect (i) spa encoding the staphylococcal protein A (Kahl et al., 2005 (link)), (ii) mecA and mecC encoding methicillin resistance (Oliveira and de Lencastre, 2002 (link); Stegger et al., 2012 (link)), (iii) scn, a marker of IEC encoding staphylococcal complement inhibitor protein (scn-F1: 5′TACTTGCGGGAACTTTAGCAA3′ and scn-R1: 5′AATTCATTAGCTAACTTTTCGTTTTGA3′, amplicon size: 130 bp), (iv) the CC398-specific sau1-hsdS1 variant (Stegger et al., 2011 (link)) using a newly designed forward primer FP2sau1: 5′GAGAATGATTTTGTTTATAACCCTAG3′ (amplicon size 106 bp), and (v) lukF-PV, a marker of the Panton-Valentine leucocidin (PVL) (Deurenberg et al., 2004 (link)). The PCR reactions were carried out in a final volume of 13 μl containing 1 × Qiagen Multiplex PCR Master Mix (Qiagen, Germany), 2 μM of each primer, and 1 μl of bacterial DNA. The following PCR conditions were used: initial denaturation at 94°C for 15 min, followed by 25 cycles consisting of denaturation (94°C for 30 s), annealing (59°C for 60 s), and extension (72°C for 60 s), and a final extension step at 72°C for 10 min. All S. aureus isolates were spa-typed as described previously (Harmsen et al., 2003 (link)). BURP cluster analysis of the spa types was performed in the Ridom StaphType software (Ridom GmbH, Germany) using default settings to deduce likely multi-locus sequence types of methicillin-susceptible S. aureus (MSSA) isolates. The staphylococcal cassette chromosome mec (SCCmec) types and subtypes were determined by PCR for all CC398 isolates (Larsen et al., 2016a (link)). The IEC type was determined by the presence of the scn, chp, sak, sea, and sep genes (van Wamel et al., 2006 (link)).
Free full text: Click here
