Knock-in Targeting of Rosa26 Locus with Snail

Rosa26 targeting by a knock-in strategy was performed based on the pROSA26–1 plasmid^{59 (link)}. Murine Snail cDNA (Snai1 cDNA; Library: IRAV MGC Mouse verified full length amplified cDNA; Clone: IRAVp968A0443D6, German Science Centre for Genome Research) was cloned into the targeting vector 3´ of a loxP-flanked transcriptional and translational stop element (loxP-stop-loxP, LSL) with a neomycin resistance cassette (Supplementary Fig. S1a). The targeting vector was linearized, electroporated into W4/129S6 embryonic stem cells, selection with 250 µg/ml geneticin imposed, and correctly targeted cell clones identified by PCR^{59 (link)}. Gene targeting was verified by Southern blot with an external ³²P-labeled 5´ probe and EcoRV digested genomic DNA (Supplementary Fig. S1b). The Southern blot images were processed with an Amersham automatic Hyperprocessor (Amersham Biosciences). Two verified cell clones were injected into C57BL/6 J blastocysts (Polygene). Germ-line transmission was achieved in 2/2 clones harbouring the targeted allele. The mice were genotyped using a 3-primer PCR strategy (ref. ^{59 (link)}, Table 1 and Supplementary Fig. S1c).Table 1

Recombination PCR primers for LSL-Rosa26^Snail allele

Name of PCR	Name of primer	Sequence (5’ – 3’)
LSL-Rosa26Snail recombination	R26-GT forward	AAAGTCGCTCTGAGTTGTTAT
	R26-Stop cassette reverse	TGAATAGTTAATTGGAGCGGCCGCAATA
	Snail-cds reverse	GCGCTCCTTCCTGGT