Immortalized Mouse Embryonic Fibroblast Knockdown
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : Rockefeller University
Variable analysis
- Cre recombinase introduced by two retroviral infections with Hit&Run Cre in pMMP at 12-h intervals
- Adeno-GFP (Vector Biolabs 1060) and Adeno-Cre (Vector Biolabs 1700)
- Mouse Trf1 cDNA and the mutants cloned into the pLPC-Myc-Puro or the pWZL-FLAG-Hygro vectors
- ShPold3 (TRCN0000279480) and a control shLuc (CGCTGAGTACTTCGAAATGTC) cloned into the pLKO.1 vector
- Spironolactone purchased from Sigma (S3378)
- CDK7i YKL-5-124 from SelleckChem (S8863)
- Cell phenotypes or other measured outcomes not explicitly mentioned
- SV40-LT-immortalized Trf1^F/F and Blm^F/F MEFs
- DMEM (Cellgro) supplemented with 100 U/mL penicillin (Gibco), 100 μg/mL streptomycin (Gibco), 0.2 mM L-glutamine (Gibco), 0.1 mM nonessential amino acids (Gibco), and 10% bovine calf serum (HyClone)
- Adeno-GFP (Vector Biolabs 1060) as a control for Adeno-Cre (Vector Biolabs 1700)
- ShLuc (CGCTGAGTACTTCGAAATGTC) as a control for shPold3 (TRCN0000279480)
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!