Immortalized Mouse Embryonic Fibroblast Knockdown

SV40-LT-immortalized Trf1^F/F and Blm^F/F MEFs were described previously (Chester et al. 1998 (link); Sfeir et al. 2009 (link); Wu et al. 2012 (link)). MEFs were cultured in DMEM (Cellgro) supplemented with 100 U/mL penicillin (Gibco), 100 μg/mL streptomycin (Gibco), 0.2 mM L-glutamine (Gibco), 0.1 mM nonessential amino acids (Gibco), and 10% bovine calf serum (HyClone). Cre recombinase was introduced by two retroviral infections with Hit&Run Cre in pMMP at 12-h intervals. Adeno-GFP (Vector Biolabs 1060) and Adeno-Cre (Vector Biolabs 1700) were used as indicated in experiments that used Adeno-Cas9. In all experiments involving Cre or Cas9, cells were harvested 120 h after the initial introduction of the virus. Mouse Trf1 cDNA and the mutants were cloned into the pLPC-Myc-Puro or the pWZL-FLAG-Hygro vectors. MEFs infected with retroviral vectors were selected with 2.5 μg/mL puromycin or 135 μg/mL hygromycin for 3 d. shPold3 (TRCN0000279480) and a control shLuc (CGCTGAGTACTTCGAAATGTC) were cloned into the pLKO.1 vector. Spironolactone was purchased from Sigma (S3378), and CDK7i YKL-5-124 was from SelleckChem (S8863).