Quantifying Gene Knockdown in Drosophila

Gal4-Hsp 70 virgin female flies were crossed to UAS-RNAi males. The adult offspring were heat shocked for 45 min at 37°, three times a day at 1-hr intervals, for 2 d. Only female offspring of the cross with UAS-Ptp61F RNAi and UAS-CG8636 RNAi and male offspring of UAS-Fer3hch and UAS-mib2 RNAi were used in this experiment. The RNA was extracted from 5 to 15 heat-shocked offspring using a Qiagen RNeasy mini kit. DNase I digestion (Fermentas) followed by cDNA synthesis (BioRad iScript) was performed using 1 µg of the purified RNA. qRT-PCR was implemented using 300 ng cDNA, 2 µl primer mix (10 µM), and 10 µl iTaq Universal SYBR Green Supermix (BioRad) in a 20 µl reaction. The qRT-PCR experiments were carried out on three biological replicates, each in technical triplicates. Heat shock-driven mCherry RNAi flies were used as a control. Ribosomal protein L32 (rp49) was used as a reference gene. Primers for Ptp61F, Fer3hch, and mib2, listed in Table S2, were designed according to the fly primer bank (Hu et al. 2013 (link)) (http://www.flyrnai.org/flyprimerbank). Primers used for rp49 were: Forward, GTGAAGAAGCGCACCAAGCAC, Reverse, ACGCACTCTGTTGTCGATACCC. Primers for CG8636 were: Forward, AATCAGAATGCCGGGCGTTGA, Reverse, TCACGTACTTCTGTCCGTTCT.