Total RNA was treated with DNase I (Invitrogen), and then reverse-transcribed using random hexamers at 37°C with the M-MLV reverse transcriptase (Promega, Madison, USA). Real-time quantitative RT-PCR was performed using SYBR Green (GeneCopoeia, USA) in a Real-time PCR machine (QuantStudio 6 Flex System, Applied Biosystems, Foster City, CA). Primers for qRT-PCR are synthesized based on the publication 22 (link), except N-cadherin forward primer (5' CCACCTACAAAGGCAGAAGAGA 3'). GAPDH was used as a reference and amplified with following primer pairs: 5'GAAGGTGAAGGTCGGAGTC 3' and 5' GAAGATGGTGATGGGATTTC 3'. The relative levels of gene expression were calculated as ΔCt = Ct(gene) - Ct(reference). The 2-ΔΔCt method was used to calculate the fold-change of gene expression.
Protocol detail
Real-Time Quantitative RT-PCR for Gene Expression
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Dnase i
Gapdh
Gene
Gene expression
N cadherin
Primer
Promega
Real time pcr
Reverse transcriptase
Sybr green
Corresponding Organization :
Other organizations : Wuhan University
Top 5 similar protocols
Variable analysis
independent variables
- Treatment of total RNA with DNase I (Invitrogen)
- Relative levels of gene expression calculated as ΔCt = Ct(gene) - Ct(reference)
- GAPDH as a reference gene amplified with 5'GAAGGTGAAGGTCGGAGTC 3' and 5' GAAGATGGTGATGGGATTTC 3' primer pairs
- Positive control: Not explicitly mentioned
- Negative control: Not explicitly mentioned
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!