AAV cassettes were designed with either D8-hGALNS or native hGALNS downstream of a TBG promoter or a ubiquitous CAG promoter, including a cytomegalovirus enhancer element, a chicken β-actin promoter, and an intron incorporated into a single promoter sequence (Figure 1 ). All the hGALNS sequences were codon-optimized. The D8-hGALNS region contained codon-optimized hGALNS preceded by a bone-targeting aspartic acid octapeptide (GACGACGATGATGACGATGACGAC). The hGALNS sequences (GenScript, Piscataway, NJ) were incorporated into the vector upstream of a rabbit β-globin polyadenylation tail. Our previous study demonstrated successful in vitro enzymatic activity in Huh7 cells [23 (link)].
Proprietary protocols developed at REGENXBIO (REGENXBIO Inc. Rockville, MD, USA) were followed to produce all research-grade AAV vectors used in the studies described here. Briefly, triple transfection of HEK293 cells was performed with the AAV8 capsid plasmid, helper plasmid, and the respective transgene plasmid. Affinity chromatography was performed on cell culture supernatant, and the purified vectors were titered utilizing Digital Droplet PCR (Biorad, Hercules, CA, USA).
Proprietary protocols developed at REGENXBIO (REGENXBIO Inc. Rockville, MD, USA) were followed to produce all research-grade AAV vectors used in the studies described here. Briefly, triple transfection of HEK293 cells was performed with the AAV8 capsid plasmid, helper plasmid, and the respective transgene plasmid. Affinity chromatography was performed on cell culture supernatant, and the purified vectors were titered utilizing Digital Droplet PCR (Biorad, Hercules, CA, USA).
Free full text: Click here
