Microbiome analysis was performed according to the previous reports.(22 (link),23 (link)) Briefly, the QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA) was used to extract genomic DNA from the collected fecal pellets. Microbiome analyses by 16S rRNA gene sequencing were conducted by Takara Bio Inc. DNA specimen from feces was amplified using a 16S (V3–V4) metagenomic library construction kit for NGS (Takara Bio Inc., Kusatsu, Japan) with primer pairs 341F (5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGTCTCGTGGGCTCGG -3') corresponding to the V3–V4 region of the 16S rRNA gene. The amplicons were purified and prepared for the sequencing library by using AMPure XP beads (Beckman Coulter, Brea, CA). The purified amplicon library was sequenced on an Illumina Miseq platform (Illumina Inc., San Diego, CA) at the Biomedical Center at Takara Bio. The processing of sequence data, including chimera check, operational taxonomic unit (OTU) definition, and taxonomy assignment, was performed using QIIME 2,(24 (link)) DATA2,(25 (link)) and VSEARCH.(26 (link))
Protocol detail
Microbiome Analysis by 16S rRNA Sequencing
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Top 5 similar protocols
Variable analysis
independent variables
- The QIAamp Fast DNA Stool Mini Kit (Qiagen, Valencia, CA) was used to extract genomic DNA from the collected fecal pellets.
- Microbiome analyses by 16S rRNA gene sequencing were conducted by Takara Bio Inc.
- DNA specimen from feces was amplified using a 16S (V3–V4) metagenomic library construction kit for NGS (Takara Bio Inc., Kusatsu, Japan) with primer pairs 341F and 806R corresponding to the V3–V4 region of the 16S rRNA gene.
- The amplicons were purified and prepared for the sequencing library by using AMPure XP beads (Beckman Coulter, Brea, CA).
- The purified amplicon library was sequenced on an Illumina Miseq platform (Illumina Inc., San Diego, CA) at the Biomedical Center at Takara Bio.
- Microbiome composition and diversity
- The processing of sequence data, including chimera check, operational taxonomic unit (OTU) definition, and taxonomy assignment, was performed using QIIME 2, DATA2, and VSEARCH.
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!