Methylation Analysis of CRBN Promoter

The genomic DNA was extracted from the cultured cells and subjected to MS-PCR analysis as described [36 (link)]. Briefly, U266 and MM1.R cells were treated with DMSO control, 8 μM LG100754, 4 μM Bexarotere, 4 μM AGN194204, or 4μM LG101506 for 48 h. The cells were then harvested, and the DNA was isolated using a tissue/cell genomic DNA isolation kit with the Wizard DNA clean-up kit (Promega, Fitchburg, WI, USA). The DNA was then treated with bisulfite according to the manufacturer’s instructions (EZ DNA Methylation Kit, Zymo Research, Irvine, CA, USA), and amplified by PCR with two pairs of specific primers that recognize the methylated (M) and the unmethylated (U) CpG sites in the CRBN promoter. The primers were designed using the MethPrimer program (http://www.urogene.org/methprimer/ accessed on 23 June 2023). The primer pair for the methylated form (129 bp) was as follows: forward: GAATAAAGTGAGGGTTTTGTAGC; reverse: ACCTAAAAATAATAACCTAAACGAA. The primer pair for the unmethylated form (131 bp) was the following: forward: TGGAATAAAGTGAGGGTTTTGTAGT; reverse: ACCTAAAAATAATAACCTAAACAAA. The PCR amplification conditions were 95 °C for 5 min; 40 cycles at 95 °C for 45 s, 60 °C for 45 s, 72 °C for 45 s, and, finally, 10 min at 72 °C. The PCR products were visualized in Gene Genius (Syngene, Cambridge, UK) by ethidium bromide staining in 2% agarose gels.