Bulk Sequencing of Antigen-Specific T Cells

For the bulk sequencing of sorted antigen-specific T cells, we used our previously published protocol for repertoire sequencing with purified mRNA as the template with some modifications^{26 (link)}. In short, the method is based on the template switch mechanism in the reverse transcriptase which adds an anchor sequence at the 3’ end of the new synthesized ss cDNA (Clontech’s SMARTScribe TM reverse transcriptase). The template switch oligo also includes random nucleotides for unique molecular barcoding (isoC-GCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNrGrGrG). The whole transcriptome was amplified with Clontech SeqAmp Polymerase. Based on the obtained ds cDNA as template TCR specific amplification was succeeded through a specific TCR constant primer (TRB: TGCTTCTGATGGCTCAAACACAGCG) using the NEB Q5 polymerase. Beckmann SPRIselect purification was used to clean the PCR product before sequencing on Illumina MiSeq. Filtering and merging of reads were done as previously described and VDJ and CDR3 annotations were assigned using IMGT/HighV-Quest (IMGT®).