Overexpression of hTSG-6 in hMSCs

Total RNA was isolated from hMSC cells that were stimulated to express TSG-6 by incubation of 3 × 10⁴ cells/cm² over night with 10 ng/ml of TNF-α in CCM containing a reduced concentration of 2% FBS [32 (link)]. About 1 μg of total RNA was used to produce the first strand cDNA pool by RT-PCR (Superscript II/oligo dT_12-18; Invitrogen) using a thermocycler (C100TM Thermal Cycler; BIO-RAD, Hercules, CA). cDNAs encoding hTSG-6 (GenBank accession number: NM_007115) were amplified by PCR using the following primers: 5’- CGGGGTACCATGATCATCTTAATTTACTT -3’ (sense), 5’- GGTGATCAGTGGCTAAATCTTCCA -3’ (anti-sense). The PCR products were sub-cloned into the Kpn I and Spe I sites in multi-cloning sites of a pEF4-Myc/His plasmid (cat, # V942-20; Invitrogen) and the plasmid was amplified in E.coli DH5α cells (cat. # 18265–017; Invitrogen).