Quantifying miRNA and mRNA Expression

Total RNA in cells was isolated using TRIzol reagent (Thermo Fisher Scientific), according to the previous description [21 (link)]. Then, All-in-One™ miRNA Prime Script™RT reagent kit (Takara, Shiga, Osaka, Japan) was used for reverse-transcription according to manufacturer’s instructions. qPCR was performed in a 20 μL total reaction volume comprised of 10 μL of SYBR Green qPCR Master Mix (2×) (Bio-Rad Laboratories, Lnc., Hercules, CA, USA), 1 μL of each gene-specific primer, 2 μL of cDNA templates, and 6 μL of PCR-grade water. Reactions were conducted on the 7500 Fast Real-Time PCR system (Thermo Fisher Scientific) in line with manufacturer’s protocol: denaturation at 94 °C for 2 min, 94 °C for 30 s, 54 °C for 30 s, 72 °C for 35 s, 30 cycles. The relative expressions were calculated by the 2^−ΔΔCt method and normalized to internal U6 small nuclear RNA (U6-snRNA, for miRNA) and GAPDH (for mRNA). The primers for miR-212-3p and U6 were purchased from Sangon Biotech (Shanghai, China). Primer sequences (5’-3’) of HMGA2 and GAPDH for qPCR were listed as follows: HMGA2-F (ATGAGCGCACGCGGTGAGGGC), HMGA2-R (GTTAGAAGACTCAAAGGAACAG), GAPDH-F (AAGCTGGTCATCAATGGGAAAC), GAPDH-R (ACCCCATTTGATGTTAGCGG).